Stigmella vimineticola (Frey, 1856)
EOL Text
Stigmella vimineticola:
 |
This article does not cite any references or sources. (April 2011) |
Stigmella vimineticola is a moth of the Nepticulidae family. It is found from Norway to Spain and Italy, and from France to Slovakia.
Damage
The larvae feed on the leaves of Salix eleagnos and Salix incana. They mine the leaves of their host plant. The mine they produce resembles the mine of Stigmella obliquella.
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Stigmella_vimineticola&oldid=614079988 |
Barcode data: Stigmella vimineticola:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 6 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACTTTATATTTTATATTTGGAATTTGATCAGGAATAGTAGGAACATCCCTAAGATTATTAATTCGAGCAGAATTAGGAAACCCAGGATCATTAATTGGTGATGATCAAATTTATAATACAATTGTAACTGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCATTTCCACGATTAAATAATATGAGATTTTGGTTACTGCCCCCTTCATTAACCTTATTAATTTCGAGAAGAATCGTTGAAAATGGAGCTGGTACAGGTTGAACGGTATATCCTCCTTTATCAGCTAATATTGCTCATAGAGGAAGTTCAGTAGATTTAGCTATTTTTTCATTACATCTAGCTGGTATTTCATCTATTTTAGGAGCAATTAATTTCATTACTACAGTAATTAATATACGAGCCTACGGAATATCTTTTGACCAAATACCTTTATTTGTATGAGCTGTAGCTATTACTGCTTTATTATTATTATTATCATTACCAGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTTTTTGACCCAGCCGGGGGAGGAGATCCAATTCTTTATCAACATTTATTTTGAT
-- end --
-- end --
Statistics of barcoding coverage: Stigmella vimineticola:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1