Ectoedemia phyllotomella (Klimesch, 1946)
Ectoedemia phyllotomella
Diagnostic description:Diagnosis. Adults not separable from heringi, although head slightly lighter. Female separated from subbimaculella by narrower convolutions of ductus spermathecae. Mines very characteristic by circular "cut-out".
Morphology:Description. Male. Forewing length 2.16 — 2.24 mm, wingspan 4.9 — 5.2 mm. Antennae with 30 — 34 segments. Head: frontal tuft yellowish orange, on vertex fuscous. Further as subbimaculella.
Female. Forewing length 2.04 mm, wingspan 4.6 mm. Antennae with 23 segments.
Male genitalia. Similar to subbimaculella. Capsule length 233 — 253 µm (3). Valva length 193—210 µm (3). Aedeagus 214—236 µm (2).
Female genitalia. T7 with a row of 8 setae. T8 with 2 — 5 setae at each side. Anal papillae with 8 — 9 setae. Corpus bursae 515 — 530 µm, longest signum 386 — 390 µm, shortest 339 — 356 µm, 4.6 — 4.9 x as long as wide. Ductus spermathecae with 2 very inconspicuous convolutions.
Larva not examined.Associations:Hostplant: Quercus cerris L..Mine. Egg on leaf upperside, against midrib. Early gallery narrow, following vein or midrib; later becoming highly contorted gallery with linear frass, often forming false blotch. The larva cuts out an oval case from the end of the mine, in which it pupates. The case does not fall immediately to the ground, but after some time, by weathering of the leaf.
Distribution:Still only known from Italy, where it can be found in large numbers as recorded here.
Life cycle:Life history. Univoltine. Larvae in October-November, adults in April-May.
Citation:This taxonomic description is based on Van Nieukerken (1985) and Van Nieukerken et al (2010).
EOL Text
Statistics of barcoding coverage: Ectoedemia phyllotomella:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Ectoedemia phyllotomella:
Ectoedemia phyllotomella is a moth of the Nepticulidae family. It is only known from Liguria and Lucania in northern Italy.
The wingspan is 4.6-5.2 mm. Adults are on wing from April to May. There is one generation per year.
The larvae feed on Quercus cerris. They mine the leaves of their host plant. The mine consists of a narrow corridor running along the midrib or a side vein. Later the corridor becomes free and then is strongly contorted, often forming a secondary blotch. The frass is concentrated in a central line. When fully grown, the larva makes an oval excision in the mine, and pupates there. The excision only drops out of the mine with the withering of the leaf.
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_phyllotomella&oldid=620787720 |
Barcode data: Ectoedemia phyllotomella:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 4 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGGAACTTTATATTTTATATTTGGAATTTGATCAGGAATAATTGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATCATTAATTGGTGATGATCAAATTTATAATACAATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCATTTCCCCGATTAAATAATATAAGATTTTGACTTCTCCCCCCTTCTTTAACTTTATTAATTTCAAGAAGAGTTGTCGAAAATGGAGTAGGGACTGGATGAACAGTTTACCCTCCATTATCTGCAAATATTGCTCATAGAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTGTAATTAATATACGAGCATATGGAATATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGCAATTACAGCTCTTCTTTTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTATAGGAGGGGGAGACCCAATTCTTTATCAACATTTATTTTGAT
-- end --
-- end --