Ectoedemia heringi (Toll, 1934)
Ectoedemia heringi
Diagnostic description:Diagnosis. Distinguished from E. subbimaculella by the darker head and the ductus spermathecae in the female; the species is slightly smaller than subbimaculella. Adults not separable from phyllotomella or liechtensteini. In the mine there is no slit, which makes it very similar to the mine of E. albifasciella, however, heringi usually feeds towards the midrib.
Morphology:Description. Male. Forewing length 1.88 — 2.4 mm (2.18 ± 0.18, 14), wingspan 4.2—5.3 mm. Head: frontal tuft ferruginous, on vertex brown to black, a sharp delimitation of the light and dark area at the level of antennal insertion; collar similar to vertex. Antennae with 29 — 32 (-36) segments (31 ± 2.0, 13). Thorax and forewing as in E. subbimaculella, but basal spot often larger. Hindwing with costal bristles. Female. Forewing length 1.88 — 2.44 mm (2.14 ± 0,18, 8). Antennae with 22—25 segments (23.4 ± 1.3,7).
Male genitalia. Capsule 230—270 µm (249,6 ± 14.6, 12). Tegumen broadly rounded, slightly less producing than in subbimaculella. Gnathos with rather short and broad, rounded central element. Valva length 175 — 215 µm (195.4 ± 10.2, 12), tip blunt, broader than in subbimaculella, inner margin straight, or hardly convex in proximal third, concave apically. Aedeagus 205—255 µm (228.6 ± 14.3, 12). Several specimens are not separable from subbimaculella.
Female genitalia. T7 with a row of 6 — 10 setae along posterior margin. T8 with two lateral groups of scales and 1 — 3 setae. Anal papillae with 9 — 15 setae. Corpus bursae 410 — 660 µm; longest signum 347—463 µm (395.5 ± 35.9, 11), shortest 309—420 µm (350.1 ± 33.6, 10), 4.4 — 5.8 x as long as wide. One specimen with much smaller signa: 257, 287 µm. Ductus spermathecae with 2 — 2¼ narrow convolutions.
Larva. Translucent yellowish white, or greenish white, with dark brown head-capsule. Ganglia usually conspicuous, but sometimes less so. Ventral plates absent. Separated from albifasciella by darker head.Associations:Hostplants: Quercus pubescens Willd., Q. robur L., Q. petraea (Matt.) Liebl., Q. faginea Lam., Q. ithaburensis Decne subsp. macrolepis (Kotschy) (new record), Castanea sativa Miller. Leafmines are inseparable from those of E. albifasciella and contorta. Mine. Egg on the upperside beside a vein, often the midrib. Mine starts as narrow linear gallery following vein, usually towards midrib, abruptly changing into a blotch, or false blotch, without slit, usually in angle between midrib and lateral vein. Sometimes the last part resembles more a wide gallery than a blotch.
Distribution:Netherlands: Van Nieukerken et al. 1993; Belgium: De Prins 1998; Nieukerken 2006; Portugal: Van Nieukerken et al. 2004a; Greece: Laštůvka and Laštůvka 1998. Here recorded new for Crete.
Apparently lacking in Scandinavia, scarce in south east England.Life cycle:Life history. Univoltine. Larvae found from September to November; adults fly from May to July.
Citation:This taxonomic description is based on Van Nieukerken (1985) and Van Nieukerken et al (2010).
EOL Text
Statistics of barcoding coverage: Ectoedemia heringi:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 25
Species With Barcodes: 1
Barcode data: Ectoedemia heringi:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 30 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGGAACTTTATATTTTATATTTGGAATTTGATCAGGAATAATTGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATCATTAATTGGTGATGATCAAATTTATAATACAATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCGTTCCCCCGATTAAATAATATAAGATTTTGACTTCTCCCCCCTTCTTTAACTTTATTAATTTCAAGAAGAGTTGTCGAAAATGGAGTAGGGACTGGGTGAACAGTTTACCCCCCATTATCCGCAAACATTGCTCATAGAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTGTAATTAATATACGAGCATATGGAATATCATTTGATCAAATACCTTTATTTGTATGGGCAGTAGCAATTACAGCTCTTCTTTTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGATCCTATAGGAGGGGGAGACCCAATTCTTTACCAACATTTATTTTGAT
-- end --
-- end --
Ectoedemia heringi:
Ectoedemia heringi is a moth of the Nepticulidae family. It is found from southern Great Britain to Poland and further east to central Russia.
The wingspan is 4.2-5.3 mm. Adults are on wing in May in the south and in June and July more in the north. There is one generation per year.
The larvae feed on Castanea sativa, Quercus faginea, Quercus macrolepis, Quercus petraea, Quercus pubescens and Quercus robur. They mine the leaves of their host plant. The mine consists of a narrow corridor with a broad frass line, running along a vein. Normally, the corridor runs along the midrib. It may also run along a lateral vein, in which case the direction usually is towards the midrib. The corridor widens into a blotch laying against the midrib. Pupation takes place outside of the mine.
The name honours the German entomologist Erich Martin Hering.
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_heringi&oldid=648960683 |