Ectoedemia subbimaculella (Haworth, 1828)
Ectoedemia subbimaculella
Diagnostic description:Diagnosis. From most other Ectoedemia species distinguished by the white basal spot on the forewing and absence of hair-pencil in male. Very difficult to separate from other species in the complex, which have usually a darker head and are slightly smaller. The differences in the male genitalia are not diagnostic. The female can be separated by the wider convolutions in the ductus spermathecae. E. subbimaculella is most easily identified by the dark larval head and prothorax and the slit in the mine.
Morphology:Description. Male. Forewing length 2.24 — 2.8 mm (2.50 ± 0.15, 26), wingspan 4.8 — 6.1 mm. Head: frontal tuft yellowish orange, sometimes with fuscous scales on vertex; collar dark brown. Antennae with 31 — 36 segments (33.3 ± 1.3, 21). Thorax black, with some white scales at tips of mesoscutum and tegulae. Forewing blackish fuscous with a white basal spot along dorsal margin, a dorsal spot in middle and a costal spot before middle, sometimes uniting to form a fascia. Hindwing without hair-pencil, but with costal bristles.
Female. Forewing length 2.16 — 2.8 mm (2.52 ± 0.19, 25). Antennae with 24—29 segments (25.7 ± 1.1, 24).
Male genitalia. Capsule length 231—304 µm (274.1 ± 19.2, 24). Tegumen produced into rounded pseuduncus. Gnathos with central element gradually narrowing to rounded tip. Valva length 193—244 µm (222.7 ± 13.8, 25), apically gradually narrowed into blunt tip; inner margin little convex to concave, serrate by prominent sockets of many setae on inner and dorsal surfaces. Aedeagus 210—261 µm (243.5 ± 14.3, 23), carinae with variable number of spines.
Female genitalia. T7 with a row of 6 — 10 setae along anterior margin of T8; T8 with two lateral groups of scales and 3 — 7 setae each; S8 with converging margins. Anal papillae with 9 — 16 setae. Vestibulum with vaginal sclerite, a dorsal spiculate pouch, and a group of densely packed pectinations near entrance of ductus spermathecae. Corpus bursae 450 — 710 µm, without pectinations; signa dissimilar, longest 390—514 (459.0 ± 34.3, 11), shortest 339—467 µm (408.3 ± 38.4, 11), 4.4— 5.6 x as long as wide. Ductus spermathecae with 2¼ — 2½ (rarely 3) convolutions, wider than in heringi, narrower than in albifasciella.
Larva. Translucent glossy white, with dark brown or black head-capsule and prothoracic plate. Ganglia more or less conspicuous. Ventral plates absent.Associations:Host plants: Quercus robur L., Q. petraea (Mattuschka) Liebl., Q. pyrenaica Willd. and Q. pubescens Willd., a few mines known from Q. cerris L. in Bosnia. Rarely on Q. rubra L. In botanical gardens on a wide variety of deciduous oaks.
Mine. Egg on upperside of leaf, beside vein. Mine: narrow linear gallery along vein, abruptly changing in blotch, usually in angle between midrib and lateral vein. The larva makes a slit in the under epidermis, through which water and frass fall out of the mine. In Austrian mines on Q. pubescens the slit was often in the upper epidermis or in both surfaces. When the egg is laid along a lateral vein, the larva usually feeds towards the midrib.Distribution:Widely distributed in West and Central Europe, in Scandinavia only in southern Sweden and Denmark, most northern records being misidentifications (R. Johansson, pers. comm.).
Ireland: Shackleton 1977; Estonia: Kerppola 1994; Latvia: Savenkov 1989; Lithuania: Diškus 2003; Spain, Van Nieukerken et al. 2004a; Greece: Laštůvka and Laštůvka 1998. Here recorded new for San Marino and Tunisia.Life cycle:Univoltine, larvae from September until November, adults flying from May to July.
Citation:This taxonomic description is based on Van Nieukerken (1985) and Van Nieukerken et al (2010).
EOL Text
Statistics of barcoding coverage: Ectoedemia subbimaculella:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 28
Species With Barcodes: 1
Barcode data: Ectoedemia subbimaculella:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 31 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGGAACTTTATATTTTATATTTGGAATTTGATCAGGAATAATTGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGTAACCCAGGATCATTAATTGGTGATGATCAAATTTATAATACAATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGATTAAATAATATAAGATTTTGACTTCTCCCCCCTTCTTTAACTTTATTAATTTCAAGAAGAGTTGTCGAAAATGGAGTAGGAACTGGATGAACAGTTTACCCTCCATTATCTGCAAATATTGCCCATAGAGGGGCATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTGTAATTAATATACGAGCATATGGAATATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGCAATTACAGCTCTTCTTTTATTATTATCTTTACCAGTATTAGCTGGTGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGATCCTATAGGAGGAGGAGACCCAATTCTTTATCAACATTTATTTTGAT
-- end --
-- end --
Ectoedemia subbimaculella:
Ectoedemia subbimaculella is a moth of the Nepticulidae family. It is found in most of Europe, east to Smolensk, Kaluganorth and the Volga and Ural regions of Russia.
The wingspan is 5–6 mm.
The larvae feed on Castanea sativa, Quercus frainetto, Quercus macranthera, Quercus petraea, Quercus pubescens, Quercus pyrenaica, Quercus robur and Quercus rubra. They mine the leaves of their host plant. The mine consists of a narrow corridor, filled with frass, running along a vein (usually the midrib, but sometimes a lateral vein and then running in the direction of the midrib). The corridor widens into a blotch. The larva makes a slit in the lower epidermis of the blotch, by which part of the frass is ejected. Pupation takes place outside of the mine.
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_subbimaculella&oldid=648959634 |