Ectoedemia heringella (Mariani, 1939)
Ectoedemia heringella
Diagnostic description:Diagnosis. Very similar to ilicis, but male easily separated (also from most other species) by patches of brown androconial scales on hindwing upperside and forewing underside. Female cannot always be separated with certainty from ilicis, but usually heringella has some white scales in the region of the costal spot and also has slightly longer signa.
Morphology:Description. Male. Forewing length 2.08 — 2.68 mm (2.43 ± 0.13, 19), wingspan 4.4 — 6.0 mm. Head: frontal tuft yellowish white to orange, in specimens from Cyprus fuscous on vertex; collar yellowish white. Antennae with 35 — 42 segments (38.4 ± 1.8, 15); scape with some brown scales in posterior distal corner. Thorax and forewings brown with some scattered white scales; medial dorsal spot white, some white scales along costa, not forming a distinct costal spot; underside of forewings with basally an elongate patch of brown (androconial) scales. Hindwing without hair-pencil, but with costal bristles; in basal half with a patch of brown (androconial) scales on upperside.
Female. Forewing length 2.24 — 2.60 mm (2.44 ± 0.20, 14), wingspan 4.6 — 5.8 mm. Antennal segments 27 — 32 (29.9 ± 1.4, 16). Without patches of brown scales on underside forewing or upperside hindwing.
Male genitaha. Capsule length 236—283 µm (252.9 ± 16.5, 9). Tegumen broad and rounded.
Gnathos with central element divided, distal part spatulate, basal part with serrate margin. Valva length 180 — 223 µm (209.0 ± 17.2, 9), inner margin almost straight or concave, tip prominent, slightly truncate. Aedeagus 257 — 300 µm (274.3 ± 16.5, 9) carinae single, bi- or trifurcate.
Female genitaha. T7 wJth a distinct row of 8 — 12 long setae along anterior margin of T8. T8 with two groups of 2 — 4 setae (7 in Cyprus specimen), without scales, but some scales present in specimen from Corsica; T8 narrow, with slightly sinuous posterior margin. Anal papillae with 8 — 15 setae. Vestibulum with vaginal sclerite, a dorsal spiculate pouch and a group of densely packed pectinations near the entrance of ductus spermathecae. Corpus bursae 580 — 715 µm, without pectinations; signa dissimilar, longest 407 — 583 µm (484 ± 73, 5), shortest 353—517 µm, (116 ± 73, 5), 4.0 — 4.7 x as long as wide. Ductus spermathecae with 2 indistinct convolutions.
Larva not examined.Associations:Hostplants. Quercus ilex L., Q. alnifoliae Poech., ? Q. robur L. In northern Italy the species was frequently found in localities without any evergreen oaks (G. Baldizzone, personal communication), such as the Parco NR Capanne di Marcarolo. Since in Britain in an outbreak situation mines on Quercus robur have been seen, we assume that E. heringella can also feed on deciduous Quercus.
Leafmines cannot be separated from other related gallery miners, in its distribution area mostly E. haraldi and pseudoilicis.Distribution:Widespread in Eastern Mediterranean, from Cyprus westwards to Corsica and southeastern France (Alpes Maritimes), recently recorded as invasive insect from Great Britain: Langmaid and Young 2003; Prichard 2005; Vickery 2004; Palmer 2008; Sims 2008. Records for France: Van Nieukerken et al. 2006; Greece: Laštůvka and Laštůvka 1998. Here new for Sardinia and tentatively recorded for Tunisia on the basis of two females.
Life cycle:Univoltine, larvae from November to April, adults May (April?) to July.
EOL Text
Taxonomy:
In Britain, prior to 2001 it is likely that all Ectoedemia heringella mines on Quercus ilex were assumed to be those of another species of nepticulid, Stigmella suberivora (Stainton, 1869), which was known to occur there.The gallery-mine of Stigmella suberivora is distinguished by being usually wider, less contorted and longer.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Mr Martin Honey, Natural History Museum |
| Source | No source database. |
Introduction:
Ectoedemia heringella was found by Martin Honey, one of the Museum’s Lepidoptera curators, during an on-going survey of moths in the Museum grounds.The first specimens were collected using mercury-vapour light in 1996. They were identified from genital characters as an Ectoedemia species, but could not be matched with anything illustrated in Johansson et al (1990).In 2001, Dr E J van Nieukerken, a colleague and a specialist in the Nepticulidae, visited the Museum and, based on external characters and genitalia, identified the material as Ectoedemia heringella (Mariani, 1939). This species had not previously been recorded from Britain or northern Europe.The moths were exhibited at the Annual Exhibition of the British Entomological and Natural History Society, held in November 2002 (Langmaid and Young 2003).
Look-alikes
Before Ectoedemia heringella was identified in Britain, all mines found on Quercus ilex were assumed to be made by Stigmella suberivora (Stainton, 1869), another species of nepticulid.The gallery-mine of Stigmella suberivora however, is broader, less contorted and longer than that of Ectoedemia heringella.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Mr Martin Honey, Natural History Museum |
| Source | No source database. |
Biology:
The Ectoedemia heringella larva mines the leaves of evergreen oaks such as Quercus ilex (Holm oak) or Quercus alnifolia Poech.The eggs are laid on the upper-side of a leaf, often near a vein.As the larva feeds, it produces a much-contorted gallery mine, almost filled with black frass - debris made up of droppings.Numerous larvae and mines can be found on a single leaf.Larvae have been found from November to April but mainly during January or February.Pupation takes place outside the leaf in a small, ovoid, brown cocoon, either between leaves or in leaf-litter on the ground.Adults occur from late April to end of June (Nieukerken, 1985). However, moth-trapping at 2 additional sites in London has produced specimens on dates between 4 July and 1 August.The moth’s flight period in Britain is April to August, possibly in 2 overlapping generations.Adults have a wingspan of between 4.4 and 5.8mm.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Mr Martin Honey, Natural History Museum |
| Source | No source database. |
Distribution:
In Britain, the species is confined to areas where Holm oak trees grow - usually in parks, gardens and cemeteries, particularly in the London area, or along the south coast.The extent of the known distribution of Ectoedemia heringella in Britain is mapped on the British Leafminers website.This species is also found in Corsica, Sicily, Italy, Sardinia, Croatia, Greece, southeastern France and Cyprus.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Mr Martin Honey, Natural History Museum |
| Source | No source database. |
Barcode data: Ectoedemia heringella:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 14 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGGAACTTTATATTTTATATTTGGAATTTGATCAGGTATAATTGGAACCTCATTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCGCCTGATATAGCTTTTCCACGATTAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAACTTTATTAGTTTCAAGAAGAATTGTTGAAAATGGAGTTGGTACAGGATGAACAGTTTACCCCCCTTTATCTGCTAATATTGCCCATAGAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTGTAATTAATATACGAGCATATGGAATATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGCAATTACAGCACTTCTCTTATTATTATCTTTACCAGTGTTAGCAGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGATCCTATAGGAGGGGGTGATCCAATTCTTTACCAACATTTATTCTGAT
-- end --
-- end --
Statistics of barcoding coverage: Ectoedemia heringella:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1
Ectoedemia heringella:
Ectoedemia heringella is a moth of the Nepticulidae family. It is found in the Mediterranean Region, from southern France, Corsica, Sardinia, and Italy to Cyprus. It was first recorded from Great Britain in 2002.
The wingspan is 4.4–6 mm. Adults are on wing from late April to the end of June. There is one generation per year.
The larvae feed on Quercus alnifolia and Quercus ilex. They mine the leaves of their host plant. The mine consists of a strongly contorted gallery, almost entirely filled with black frass. There are often many mines in a single leaf.
-
Mines and larvae on Quercus ilex
-
Male genitalia
-
Female genitalia
-
Female terminal abdominal segment
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_heringella&oldid=614067516 |