Ectoedemia turbidella (Zeller, 1848)
Ectoedemia turbidella
Diagnostic description:Diagnosis. Externally E. turbidella cannot be distinguished from E. albida or E. similigena, although these two are generally paler. The male genitalia are characterised by the short demarcated valval tip, the relatively longer aedeagus (1.22–1.27 × capsule length) and triangular gnathos (Hyperlink).
Female genitalia have prominent widened posterior apophyses, reaching beyond anterior ones and very short and narrow signa (5–6 cells wide, 2.7–5.1 × as long as wide) (Hyperlink). For differences from hannoverella see diagnosis of that species (Van Nieukerken 1985).Morphology:Diagnosis: see diagnosis of hannoverella for the differences between it and turbidella. The male genitalia resemble those of klimeschi, but can be recognised by the shape of the valva, with tooth-shaped tip in turbidella, and the asymmetric aedeagus in klimeschi. The female genitalia are very characteristic with the pointed ovipositor, and the long and broad apophyses.
Associations:Hostplants: Populus alba L. and P. canescens (Aiton.) Sm., only on the smaller leaves of older shoots of large trees, never on saplings. Material from Potsdam (leg. Hinneberg) is labelled with "Pop.nigr.", but this is probably incorrect. Mine (figs. 476). Egg deposited on side of petiole, about 1½— 2 cm from leaf base. Mine first straight gallery in petiole, causing swelling; final instar larva makes triangular blotch between first lateral vein and leaf margin, or less often between midrib and first lateral vein; frass deposited in two lateral lines, leaving passage for larva, which can withdraw itself in petiole.
Distribution:Widespread. In Scandinavia in southern Sweden and Denmark only, very local in the extreme east of England, locally abundant throughout central Europe. Some scattered records are known from southern Europe: Spain, Sicily. Finland: Mutanen et al. 2001; Estonia: Jürivete et al. 2000; Latvia: Šulcs and Šulcs 1984; Lithuania: Diškus 2003; Belarus: Merzheevskaja et al. 1976; Bulgaria: Chorbadziev 1915 [overlooked in 1985]; Russia: Jürivete et al. 2000; Nieukerken et al. 2004b. Iran to be removed (see E. albida).
Life cycle:Live history. Univoltine. Larvae start feeding probably in summer, mature larvae can be found in October and November, usually later than hannoverella, often in green islands in fallen leaves. The larva usually feeds in the night. Adults fly from April to June.
This taxonomic description is based on Van Nieukerken (1985) and Van Nieukerken et al (2010)
EOL Text
Barcode data: Ectoedemia turbidella:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 8 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGGAACATTATATTTTATATTTGGGATTTGATCAGGTATAGTAGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGTTCATTAATTGGTGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATACTAGGAGCCCCTGATATAGCTTTTCCACGATTAAATAATATAAGATTTTGACTTCTCCCCCCTTCTTTAACTTTATTAATTTCAAGAAGAGTTGTCGAAAATGGTGTTGGTACTGGATGAACAGTTTATCCTCCTTTATCTGCCAATATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCATCTATTCTAGGAGCTATTAATTTTATTACAACTGTAATCAATATACGAACTAATGGAATATCATTTGACCAAATACCATTATTTGTTTGAGCTGTAGCAATTACTGCTCTTCTTTTATTATTATCATTACCTGTATTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCAATAGGGGGTGGTGATCCTATTCTTTATCAACACTTATTTTGAT
-- end --
-- end --
Statistics of barcoding coverage: Ectoedemia turbidella:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Ectoedemia turbidella:
Ectoedemia turbidella is a moth of the Nepticulidae family. It is found from most of Europe (except Ireland, Greece and the Mediterranean Islands), east to the Volga and Ural regions of Russia.
The wingspan is 6–7 mm. Adults are on wing from May to June.
The larvae feed on Populus alba and Populus canescens. They mine the leaves of their host plant. It first bores in the distal part of the petiole, resulting in a local swelling. When the larva reaches the leaf it makes an elongate triangular blotch between the leaf margin and the first side vein, or sometimes between midrib and side vein. The frass is concentrated in two bands that run parallel to the sides of the mine. The larvae mainly feed at night. Pupation takes place outside of the mine.
-
Male genitalia
-
Female genitalia
-
Damage
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_turbidella&oldid=648967708 |