Ectoedemia hannoverella (Glitz, 1872)
Ectoedemia hannoverella
Diagnostic description:Diagnosis: externally easy to confuse with turbidella, but in female the blunt ovipositor of hannoverella separates it immediately from turbidella, which has a pointed ovipositor. Males with dark heads always belong to turbidella, but light-headed males can only be separated by the genitalia. These are very different in shape of valva, shape and size of carinate processes, and gnathos, which bears spines in hannoverella. From other Ectoedemia species hannoverella and turbidella can be separated by the presence of a white discal spot in basal part of forewing and many scattered white scales; males also possess a hair-pencil.
Morphology:Description.
Male. Forewing length 2.4 — 3.16 mm (2.84 ± 0.21, 18), wingspan 5.2—6.8 mm. Head: frontal tuft yellowish orange to light ferruginous; collar slightly lighter. Antennae with 44—53 segments (48.8 ± 2.8, 10). Thorax fuscous black with some white scales along frontal margin; forewings fuscous black with a variable pattern of yellowish white spots; usually a medial costal and opposite dorsal spot, sometimes fused by some, more distally placed, scales; basal half with many scattered white scales, often forming a small discal spot halfway between wingbase and costal spot, and a basal spot along dorsal margin. Specimens with almost uniform dark forewings occur. Hindwing with a yellowish-white hair-pencil, about l/5th of hindwing length.
Female. Forewing length 2.8 — 3.32 mm (3.05 ± 0.16, 14), wingspan 6.2 — 7.2 mm. Antennae ' with 29—33 segments (30.9 ± 1.6, 9).
Male genitalia. Capsule length 249—309 µm (282.9 ± 20.8, 6). Tegumen wide and rounded. Gnathos with moderately long central element, ventrally with some rows of spines. Valva length 201—236 µm (217.3 ± 11.8, 7), inner margin almost straight, except basally; outer margin strongly convex, widest part beyond middle; apex of valva not separated, hardly curved inwards, forming an almost right angle. Aedeagus 291—339 µm (309.8 ± 16.2, 7), with two pairs almost similar pointed carinae, hardly curved, without additional spines.
Female genitalia. T7 without row of setae. T8 broad, rectangular or trapezoid, with two lateral patches of scales and at least 12 — 17 setae. Anal papillae with 6 — 11 setae. Vestibulum strongly folded (heavily stained by chlorazol), with vaginal sclerite, dorsal spiculate pouch with ± 50 single and equally spaced spines, and a patch of densely packed pectinations near entrance of ductus spermathecae. Corpus bursae long and slender, 660 — 880 µm, covered with pectinations, partly in concentric bands around signa, absent in anterior part; signa almost similar, 390 — 480 µm (422.1 ± 26.4, 10), 3.4 — 3.7 x as long as wide. Ductus spermathecae with 2½— 3 convolutions.
Larva. Pale yellow. All thoracic segments and abdominal segments 8 — 10 with light brown sternites. Ventral plates absent.Associations:Hostplants: Populus nigra L. and P. × canadensis Moench. Mine (fig. 475). Egg deposited on lateral side of petiole, about one centimeter from lamma. Mine first straight gallery in petiole, causing swelling; in final instar larva enters lamina, making elongate blotch, usually between first lateral vein and leaf margin, occasionally between midrib and first lateral vein; f rass in two parallel lines, leaving passage for larva, which can withdraw itself in petiole.
Distribution:Sweden: Svensson 1987; Latvia: Savenkov 1989; Great Britain: Langmaid and Young 2004; Prichard and Clifton 2004; Spain: Van Nieukerken et al. 2004a; Lithuania: Puplesis et al. 1990; Bulgaria: Chorbadziev 1915 (overlooked in 1985, confirmed by record here); Russia (including Siberia): Van Nieukerken et al. 2004b; Puplesis 1994. Further records in France and Italy: Baldizzone 2004; Nieukerken et al. 2006. Also recorded from Northeastern China in the botanical garden of Harbin (Van Nieukerken and Liu 2000), possibly as an introduction. New record for Rumania. Also known from Denmark and Servia.
Life cycle:Live history. Univoltine. Larvae start feeding early, probably already in July, but feed very slowly; blotches with final instar larvae can be found from late September to November, often in green islands of fallen leaves. Larvae feed usually in the dark. Adults fly from May to July.
This taxonomic description is based on Van Nieukerken (1985) and Van Nieukerken et al (2010)
EOL Text
Barcode data: Ectoedemia hannoverella:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 8 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGGAACATTGTATTTTATATTTGGAATTTGATCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGTTCATTAATTGGCGATGATCAAATTTATAATACAATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCCCCTGATATAGCTTTCCCCCGATTAAATAATATAAGATTTTGACTTCTCCCCCCTTCTTTAACTTTATTAATTTCAAGAAGAGTTGTCGAAAATGGAGCAGGTACCGGATGAACAGTATACCCCCCTTTATCTGCTAATATTGCCCATAGAGGAAGATCTGTAGATTTAGCAATTTTTTCATTACATTTGGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACTGTAATTAATATACGAACTAATGGAATATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGCAATTACTGCTCTTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTATGGGTGGTGGTGATCCTATTCTTTATCAACATTTATTTTGAT
-- end --
-- end --
Statistics of barcoding coverage: Ectoedemia hannoverella:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 10
Species With Barcodes: 1
Ectoedemia hannoverella:
Ectoedemia hannoverella is a moth of the Nepticulidae family. It is found from most of Europe (except Ireland) to southern Siberia and European Russia, but it is most common in central Europe. It was not recorded in Great Britain until 2002 when mines were found in fallen leaves of Italian poplar.
The wingspan is 6–7 mm. Adults are on wing from April to May in western Europe.
The larvae feed on Populus x canadensis and Populus nigra. They mine the leaves of their host plant. They only feed at night. The first instar larva bores in the petiole, causing local swelling. Once the larva has reached the leaf disc it begins forming an elongate blotch between the leaf margin and the most lateral vein, or in some cases between the midrib and the first lateral vein. The frass is concentrated in two stripes running parallel to the sides of the mine. Pupation takes place outside of the mine.
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_hannoverella&oldid=648960706 |