Ectoedemia ivinskisi Puplesis, 1984
EOL Text
Barcode data: Ectoedemia ivinskisi:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 3 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGGAACATTATATTTTATATTCGGAATTTGATCTGGATTAGTAGGAACATCATTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGATCTCTTATTGGTGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAACTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTTTAAATAATATAAGATTTTGATTATTACCTCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTATATCCTCCTTTATCAGCTAATATTGCTCATAGAGGTAGATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACTGTTATTAATATACGAACTAACGGTATATCATTTGATCAAATACCATTATTTGTATGAGCAGTTGCTATTACTGCTCTTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCGATTACAATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGATCCAATAGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGAT
-- end --
-- end --
Statistics of barcoding coverage: Ectoedemia ivinskisi:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Ectoedemia ivinskisi:
Ectoedemia ivinskisi is a moth of the Nepticulidae family. It was described by Puplesis in 1984. It is known from the Russian Far East.[1]
References
| This article on a moth of the Ectoedemia genus is a stub. You can help Wikipedia by expanding it. |
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_ivinskisi&oldid=546020369 |