Ectoedemia occultella (Linnaeus, 1767)
Ectoedemia occultella
Diagnostic description:Diagnosis. Easily distinguished from other Ectoedemia spp. (except minimella), by completely jet-black colour of thorax and forewings, (except fascia), including cilia, and absence of cilia-line. Separated from Stigmella species by medial fascia (usually postmedial in Stigmella) and collar, consisting of hair-scales, instead of lamellar scales as in Stigmella. Separated from very similar minimella by presence of group of white scales on underside of forewing in male, and by light coloured head in female. See also minimella.
Morphology:Description. Male. Forewing length 2.36 — 3.44 mm (2.85 ± 0.33, 23), wingspan 5.1 — 7.5 mm. Head: frontal tuft black, often mixed with some fuscous or ochreous scales; collar black. Antennae with 31 — 42 segments (35.6 ± 2.9, 19). Thorax and forewings completely jet-black, less coarsely scaled than in other Ectoedemia species, with a rather broad, almost straight dull white fascia, sometimes slightly constricted in middle. Hindwing with a relatively long white hair-pencil. Underside forewing with a small elongate patch along costa with narrow white scales, often difficult to see.
Female. Forewing length 2.56 — 3.84 mm (3.28 ± 0.39, 20), wingspan 5.7—8.4 mm. Head: frontal tuft yellowish to yellowish orange, sometimes mixed fuscous; collar yellow. Antennae with 27 — 32 segments (29.4 ± 1.6). Patch of white scales on underside forewing absent.
Male genitalia. Capsule length 313—390 µm (353.6 ± 27.4, 10), very large comparing with other Ectoedemia (s.S.) species. Tegumen produced into long tapering, pointed pseuduncus. Gnathos with relatively broad, blunt central element. Valva length 236—279 µm (245 ± 8.3, 6), outer margin strongly convex, inner margin slightly concave, almost straight; tip pointed, pointing posteriorly. Aedeagus 304—351 µm (326.8 ± 17.5, 12), carinae each divided into several blunt ending digitate processes, number variable; vesica with many small, triangular cornuti only.
Female genitalia. T7 without row of setae. T8 with two groups of scales and 3 — 5 setae. Anal papillae confluent, in total with 18 to 40 setae. Vestibulum with vaginal sclerite, and a dorsal spiculate pouch with very few minute spines only. Corpus bursae 495 — 580 µm, with pectinations closely set in two lateral bands, at some distance from signa; signa dissimilar, one reaching vestibulum, longest 214 — 334 µm (275.3 ± 34.1, 9), shortest 180—266 µm (221.0 ± 27.9, 9), 2.2—3.3 x as long as wide. Ductus spermathecae with 2½ — 3 convolutions.
Larva. Pale yellowish white, ganglia not very conspicuous. Head light brown. Penultimate stages with 12 black ventral plates.Associations:Hostplants: Betula spp., Salix pentandra L. (only northern Finland, not reared). Mine. Egg on leaf underside, rarely on upperside. Mine large blotch, often almost circular, with black circular blotch in middle, caused by staining of both epidermis layers; frass black, irregular, but usually accumulated under and near blotch. Mine does not start as gallery, young mines consist of black blotch only, through which larva cannot be seen.
Distribution:One of the commonest and most widespread Ectoedemia species in Europe, occurs in almost all places where birch grows. In southern Europe probably in mountains only, and recorded from Etna, Sicily. Lithuania: Ivinskis et al. 1985; Belarus: Merzheevskaja et al. 1976; Corsica: Van Nieukerken et al. 2006. J. Buszko (in litt.) observed tenanted mines in Bulgaria (see below), thus providing a new record.
Life cycle:Life history. Univoltine. Larvae from August to November, adults fly from May to July.
Citation:This taxonomic description is based on Van Nieukerken (1985) and Van Nieukerken et al (2010).
EOL Text
Statistics of barcoding coverage: Ectoedemia occultella:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 37
Species With Barcodes: 1
Barcode data: Ectoedemia occultella:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 10 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGGAACTTTATATTTTATTTTTGGAATTTGATCTGGATTAGTGGGAACATCTTTAAGATTATTAATTCGTGCTGAACTAGGAAATCCAGGATCTTTTATTGGAGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTGCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCACGATTAAATAATATAAGATTTTGATTATTACCACCTTCTTTGACTTTATTAATCTCGAGAAGAATTGTTGAAAATGGAGCAGGTACTGGATGAACAGTTTACCCTCCTTTATCCTCTAATATTGCACATAGAGGAAGGTCAGTAGACTTAGCAATTTTCTCTTTACATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTGTAATTAATATACGAACAAATGGTATATCATTTGATCAAATACCTTTATTTGTTTGAGCAGTTGCTATTACTGCTCTTCTATTATTATTGTCATTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTATAGGAGGAGGAGACCCTATTTTATATCAACATTTATTTTGAT
-- end --
-- end --
Ectoedemia occultella:
Ectoedemia occultella, the Small Birch Leafminer, is a moth of the Nepticulidae family. It has a Holarctic distribution. It is found in most of Europe, east through Russia (where it has been recorded from Murmansk, Karelia, Leningrad, Samara and Tatarstan and Sakhalin) to Japan. It is also present in North America. Mines very similar to that of Ectoedemia occultella have been found on Rosaceae species in Nepal and Japan and these may belong to this species.
The wingspan is 5–7 mm. Adults are on wing from May to July.
The larvae feed on Betula ermani, Betula grossa, Betula humilis, Betula nana, Betula obscura, Betula pendula and Betula pubescens. It has also been recorded from Salix pentandra in Finland. They mine the leaves of their host plant. The mine consists of a round, primary, upper-surface blotch without a visible initial corridor. There are often several mines in one leaf. The mine has a dark centre, where the larva often retreats.
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_occultella&oldid=624534058 |