Ectoedemia arcuatella (Herrich-Schäffer, 1855)
Ectoedemia arcuatella
Diagnostic description:Diagnosis. When not reared almost inseparable from E. atricollis, see diagnosis for that species. Females difficult to separate from spinosella.
Morphology:Description. Male. Forewing length 1.80—2.24 mm (2.11 ± 0.17, 8), wingspan 4.0 — 4.9 mm. Head: frontal tuft yellow to ferruginous, mixed with fuscous scales, getting darker towards collar; collar fuscous to black. Antennae with 28 — 32 segments (29.9 ± 1.5, 8). Hindwing with a white hair-pencil. Further as angulifasciella.
Female. Forewing length 1.64 — 2.32 mm (2.05 ± 0.26, 10), wingspan 3.6—5.2 mm. Antennae with 24 — 28 segments (26.2 ± 1 .4, 9).
Male genitalia. Capsule length 249—253 µm (3). Gnathos. Valva length 180—189 µm (4), inner margin almost straight, forming an obtuse angle with pointed tip. Aedeagus 231 — 244 µm (4), hardly constricted.
Female genitalia. T8 with about 5 setae at each side. Anal papillae with 5 — 9 setae. Spiculate pouch with very few minute spines. Corpus bursae 420 — 500 µm; longest signum 227 — 313 µm (4), shortest 206 — 283 μm (4), 3.1 — 4.1 x as long as wide. Ductus spermathecae with 2½ convolutions.
Larva. Pale yellow, ganglia not very distinct. Head-capsule and prothoracic plate light brown. Penultimate instars with chain of brown ventral plates, which are shed in final instar.Associations:Hostplants: Fragaria vesca L., F. moschata Duchesne, F. viridis Weston, Potentilla erecta (L.) Rauschel, P. sterilis (L.) Garcke. Mine. Egg on leaf-underside. Early mine highly contorted gallery with brown, coiled frass; later widening into large irregular blotch with scattered brown frass.
Distribution:Widespread in Europe, but scarcer than the other three species of the complex. Only one record each from the Netherlands. Not yet recorded from Norway and the Iberian Peninsula. Latvia: Savenkov et al. 1996; Lithuania: Diškus 2003; Ireland: Heal 1985; Belgium: Van Nieukerken 2006; France (confirmation): Van Nieukerken et al. 2006, here recorded new from southern France. Also recorded outside Europe from Kazakhstan (Alma Ata) (Puplesis et al. 1996).
Life cycle:Life history. Univoltine, larvae from August until October, adults from May to July.
Citation:This taxonomic description is based on Van Nieukerken (1985) and Van Nieukerken et al (2010).
EOL Text
Statistics of barcoding coverage: Ectoedemia arcuatella:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 10
Species With Barcodes: 1
Barcode data: Ectoedemia arcuatella:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 12 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGGAACTTTATATTTTATATTTGGAATTTGATCTGGATTATTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTCTTATTGGAGATGATCAAATTTATAACACAATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTACCTTTAATATTAGGAGCACCTGATATAGCTTTTCCACGATTAAACAATATAAGATTTTGATTACTACCTCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGTAGGAACTGGATGAACAGTTTATCCACCTTTATCTGCTAATATTGCACACAGAGGAAGTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACCGTAATTAATATACGAGCATATGGAATATCATTTGATCAAATACCTTTATTTGTTTGAGCAGTTGCAATTACTGCACTTTTATTATTATTATCTTTACCAGTATTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCAATAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGAT
-- end --
-- end --
Ectoedemia arcuatella:
Ectoedemia arcuatella is a moth of the Nepticulidae family. It is found in most of Europe, except the Iberian Peninsula, east to and the Volga and Ural regions of Russia.
The wingspan is about 5 mm. Adults are on wing from June to July.
The larvae feed on Fragaria moschata, Fragaria vesca, Fragaria viridis, Potentilla erecta and Potentilla sterilis. They mine the leaves of their host plant. The mine consists of a narrow, strongly contorted gallery with grey brown frass. The gallery ends in an elongate blotch or broad corridor that frequently overlaps a part of the earlier mine. Pupation takes place outside of the mine.
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_arcuatella&oldid=648961184 |