Ectoedemia expeditionis Mey, 2004
EOL Text
Ectoedemia expeditionis:
Ectoedemia expeditionis is a moth of the Nepticulidae family. It was described by Mey in 2004. It is known from Namibia.[1]
References
| This article on a moth of the Ectoedemia genus is a stub. You can help Wikipedia by expanding it. |
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Ectoedemia_expeditionis&oldid=546070438 |
Barcode data: Ectoedemia expeditionis:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CATTATATTTTATTTTTGGTATTTGATCAGGTTTAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCACATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAACTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCACGACTAAATAATATAAGATTTTGATTATTACCCCCTTCACTAACTTTATTAATTTCAAGAAGAATCATCGAAAATGGAGTAGGAACAGGATGAACAGTTTATCCTCCTCTATCTGCTAATATTGCACATAGAGGAAGATCAGTAGATTTAGCTATTTTTTCTTTACATTTGGCAGGTATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACAGTAATTAATATACGAACAAATGGAATATCATTTGATCAAATACCATTATTTGTATGAGCTGTTGCAATTACTGCTTTGTTATTATTATTATCTCTCCCAGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTATAGGAGGAGGAGACCCTATTTTATATCAACACTTATTTTGAT
-- end --
-- end --
Statistics of barcoding coverage: Ectoedemia expeditionis:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1